Kinase-dead SIK2 (K49M) was generated using site-directed mutagenesis using the following primers: forward, ACCAAGACGGAGGTGGCAATAATGATAATCGATAAGTCTCAGC; reverse, GCTGAGACTTATCGATTATCATTATTGCCACCTCCGTCTTGGT

Kinase-dead SIK2 (K49M) was generated using site-directed mutagenesis using the following primers: forward, ACCAAGACGGAGGTGGCAATAATGATAATCGATAAGTCTCAGC; reverse, GCTGAGACTTATCGATTATCATTATTGCCACCTCCGTCTTGGT. Viral packaging plasmids pCMV-dr8. 91 and pCMV-VSV-G were a gift from Michael White (UTSW). However , this activity causes cell death selectively in breast cancer cells and is biased toward the claudin-low subtype. Depletion of ATG5, which is essential for autophagic vesicle formation, rescued the loss of viability following SIK2 inhibition. Importantly, we find that SIK2 is essential for TNBC tumor growthin vivo. Taken together, these findings indicate that claudin-low tumor cells rely on SIK2 to restrain maladaptive autophagic activation. Inhibition of SIK2 therefore presents itself as an intervention opportunity to reactivate this tumor suppressor mechanism. == INTRODUCTION == Breast cancer is an extremely heterogeneous disease that is classified by the presence of estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth element receptor 2 (HER2). Cases where <1% of cells express ER, PR, or HER2 are considered triple-negative breast cancer (TNBC) (1). These molecular markers can serve as a critical stratification tool for tailoring effective therapies to sensitive patients. For example , antiestrogens such as tamoxifen are highly effective in ER-positive patients, and HER2-positive tumors are responsive to trastuzumab (2, 3). Conversely, TNBC SORBS2 tumors lack these targetable proteins, limiting first-line treatment to a combination of radiation and chemotherapy. This approach has changed little over the last 20 years and is characterized by high toxicity and frequent relapse of chemorefractory disease (4). Furthermore, levels of overall and disease-free survival in TNBC are significantly worse than those of other subgroups of breast cancer (5). Thus, for TNBC there is a serious need for much less toxic therapies that target the major fulcrums supporting tumor cell survival. In addition to clinical and pathological markers, extensive gene expression profiling efforts by a number of groups have identified multiple intrinsic molecular subtypes within breast cancer. These subtypes include luminal A and B, which comprise the majority of ER- and PR-positive cases, as well a HER2-enriched clade. Importantly, this analysis has exposed substantial heterogeneity ZM323881 within TNBC. Broadly, TNBC can be subclassified into 2 intrinsic subtypes, basal like and claudin low, but up to 6 additional subclasses have been recognized (69). Significantly, these groups can be aligned with sensitivity to specific therapies and overall patient survival (4, 68, 10). A number of recent studies have indicated that the spectrum of ZM323881 subtypes foundin vivois represented among existing tumor-derived cell lines (8, 9, 11). Thus, these cell lines offer a model system that faithfully recapitulates the heterogeneity of the human being disease and could reveal subtype-selective vulnerabilities. Here, ZM323881 we have applied genome-scale loss-of-function screening in both the claudin-low and basal-like subtypes to discover molecular focuses on for TNBC. We find that salt-inducible kinase 2 (SIK2) is essential intended for survival, particularly in the claudin-low subtype. There are 3 salt-inducible kinases (SIK1, SIK2, and SIK3), which are best characterized as regulators of gluconeogenesis. Upon glucagon stimulation, protein kinase A (PKA) inactivates SIK, thereby relieving inhibitory phosphorylation of CRCT2/3, which then cooperates with CREB to activate gluconeogenic transcriptional programs (12, 13). Importantly, tissue-specific deletions of SIK proteins in mice can lead to altered glucose and lipid metabolism (1416). Additional findings have also implicated SIK2 proteins in modulating autophagy and inflammatory responses (1721). With respect to cancer, two reports have indicated that SIK2 is essential intended for centrosome splitting and mitotic progression, and SIK1 loss can inhibit anoikis and promotes metastases (2224). The contribution of SIKs to biological processes that are often misregulated in human disease has driven efforts to develop small-molecule inhibitors. SIKs are members from the AMPK family but are unique in this group, as they contain a low-stearic-hindrance residue (threonine) at their gatekeeper site (25, 26). This small residue creates an extended hydrophobic bank that enhances flexibility and, thus, autoactivation of the kinase (27, 28). This bank can also selectively accommodate small-molecule inhibitors that would otherwise be occluded by a bulky side chain. For example , AMPK contains a methionine at this residue, suggesting that SIK inhibitors would have minimal off-target activity. We find that in TNBC, SIK2 functions to restrict autophagy, which in the claudin-low subtype is essential intended for viability. The contribution of autophagy to tumorigenesis continues to be somewhat contentious. Autophagy is reported to function both as a tumor suppressor mechanism as well as a survival mechanism, depending on the.